Review



rabbit anti p jak2 primary antibody  (Bioss)


Bioz Verified Symbol Bioss is a verified supplier
Bioz Manufacturer Symbol Bioss manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Bioss rabbit anti p jak2 primary antibody
    Effect of RRTS on <t>JAK2/STAT3</t> pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
    Rabbit Anti P Jak2 Primary Antibody, supplied by Bioss, used in various techniques. Bioz Stars score: 94/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit anti p jak2 primary antibody/product/Bioss
    Average 94 stars, based on 12 article reviews
    rabbit anti p jak2 primary antibody - by Bioz Stars, 2026-02
    94/100 stars

    Images

    1) Product Images from "Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis"

    Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

    Journal: Frontiers in Pharmacology

    doi: 10.3389/fphar.2025.1506885

    Effect of RRTS on JAK2/STAT3 pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
    Figure Legend Snippet: Effect of RRTS on JAK2/STAT3 pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

    Techniques Used: Expressing, Control

    Effect of RRTS on the growth of MCF-7 cell (A) Effect on proliferation of MCF-7 cells. (B, C) Effect on MCF-7 cell migration. (D) Effects on inflammatory cytokines IL-6,TNF-α and IL-10. (E) The apoptosis rate of the cells was detected by flow cytometry (Annexin V-FITC/PI method). (F) mRNA expression of JAK2 and STAT3. (G, H) Protein expression of proteins Bax, Bcl-2, JAK2, p-JAK2, STAT3 and p-STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
    Figure Legend Snippet: Effect of RRTS on the growth of MCF-7 cell (A) Effect on proliferation of MCF-7 cells. (B, C) Effect on MCF-7 cell migration. (D) Effects on inflammatory cytokines IL-6,TNF-α and IL-10. (E) The apoptosis rate of the cells was detected by flow cytometry (Annexin V-FITC/PI method). (F) mRNA expression of JAK2 and STAT3. (G, H) Protein expression of proteins Bax, Bcl-2, JAK2, p-JAK2, STAT3 and p-STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

    Techniques Used: Migration, Flow Cytometry, Expressing, Control

    JAK2/STAT3 pathway inhibition as potential mechanism of Ranunculus ternatus Thunb. For the treatment of breast cancer.
    Figure Legend Snippet: JAK2/STAT3 pathway inhibition as potential mechanism of Ranunculus ternatus Thunb. For the treatment of breast cancer.

    Techniques Used: Inhibition



    Similar Products

    94
    Bioss rabbit anti p jak2 primary antibody
    Effect of RRTS on <t>JAK2/STAT3</t> pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
    Rabbit Anti P Jak2 Primary Antibody, supplied by Bioss, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit anti p jak2 primary antibody/product/Bioss
    Average 94 stars, based on 1 article reviews
    rabbit anti p jak2 primary antibody - by Bioz Stars, 2026-02
    94/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc primary antibodies against p jak2
    Effect of RRTS on <t>JAK2/STAT3</t> pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
    Primary Antibodies Against P Jak2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primary antibodies against p jak2/product/Cell Signaling Technology Inc
    Average 96 stars, based on 1 article reviews
    primary antibodies against p jak2 - by Bioz Stars, 2026-02
    96/100 stars
      Buy from Supplier

    Image Search Results


    Effect of RRTS on JAK2/STAT3 pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

    Journal: Frontiers in Pharmacology

    Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

    doi: 10.3389/fphar.2025.1506885

    Figure Lengend Snippet: Effect of RRTS on JAK2/STAT3 pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

    Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

    Techniques: Expressing, Control

    Effect of RRTS on the growth of MCF-7 cell (A) Effect on proliferation of MCF-7 cells. (B, C) Effect on MCF-7 cell migration. (D) Effects on inflammatory cytokines IL-6,TNF-α and IL-10. (E) The apoptosis rate of the cells was detected by flow cytometry (Annexin V-FITC/PI method). (F) mRNA expression of JAK2 and STAT3. (G, H) Protein expression of proteins Bax, Bcl-2, JAK2, p-JAK2, STAT3 and p-STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

    Journal: Frontiers in Pharmacology

    Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

    doi: 10.3389/fphar.2025.1506885

    Figure Lengend Snippet: Effect of RRTS on the growth of MCF-7 cell (A) Effect on proliferation of MCF-7 cells. (B, C) Effect on MCF-7 cell migration. (D) Effects on inflammatory cytokines IL-6,TNF-α and IL-10. (E) The apoptosis rate of the cells was detected by flow cytometry (Annexin V-FITC/PI method). (F) mRNA expression of JAK2 and STAT3. (G, H) Protein expression of proteins Bax, Bcl-2, JAK2, p-JAK2, STAT3 and p-STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

    Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

    Techniques: Migration, Flow Cytometry, Expressing, Control

    JAK2/STAT3 pathway inhibition as potential mechanism of Ranunculus ternatus Thunb. For the treatment of breast cancer.

    Journal: Frontiers in Pharmacology

    Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

    doi: 10.3389/fphar.2025.1506885

    Figure Lengend Snippet: JAK2/STAT3 pathway inhibition as potential mechanism of Ranunculus ternatus Thunb. For the treatment of breast cancer.

    Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

    Techniques: Inhibition